⚠️ Please complete the Pre-VTP Survey before you start the project
⚠️ If haven’t completed the Pre-VTP Survey please do so before you start the project
Here is a Google Sheet that contains each participant:
General Info
tab)General Info
tab)Checkpoint (CP) Results
tab)Please koin the Slack channel for this course
When you have trouble, you can:
The primary goal of this project is to use the Linux and R programming languages to bioinformatically characterize, quantify and visualize the species composition of urban microbiome samples (i.e. subway swabs) from raw data to completed analysis.
What is bioinformatics?
Think, Room (4-5 ppl), Share
:
1-minute: think about one lab, activity, or lesson you prevously taught that had an element that could have been explored using bioinformatics analysis? (Explain)
3-minutes: divide into breakout rooms and discuss with your group
2-minutes: re-join the main meeting room and present 1-2 examples to the other participants.
Why is the metagenomics application of bioinformatics useful?
In case you (or more likely, your students) are thinking, “How would someone be able to use this knowledge in real life?”, here are three real-world applications of the metagenomics analysis technique you will learn:
Research Applications
: you can ask questions about
the similarity of microbiome samples, the prevalence/emergence of
antimicrobial resistant strains, etc. The Metasub Project, which is
where the data you’ll analyze in this VTP comes from, would be an
example of this application.
Clinical Applications
: This technique is already
being employed by some biotech startups, like Karius (https://kariusdx.com/), to
rapidly diagnose blood-borne infections.
Biotech/Industry Applications
: Some companies offer
microbial surveillance services to identify and monitor the presence of
resistant pathogens (e.g. on hospital surfaces). One such startup called
Biotia (https://www.biotia.io/) was spun out of the Mason lab
(the same Cornell Med lab that created the Metasub project) and utilizes
many of the same techniques that you will employ in this VTP.”
In a broader sense, bioinformatics is a subdivision of data science; principles learned in the former are highly relevant to the latter. We’ll point these out as we go along.
History of metagenomics:
Example: Clinical Application of Metagenomics:
Think, Room (4-5 ppl), Share
:
1-minute: Come up with one potential application of metagenomics not discussed here.
3-minutes: divide into breakout rooms and discuss with your group
2-minutes: re-join the main meeting room and present 1-2 examples from your breakout room to the other participants.
To accomplish this goals in this project, we will use data from the Metasub project, an effort to characterize the “built environment” microbiomes of mass transit systems around the world, headed by Dr. Chris Mason’s lab at Weill Cornell Medical Center (http://www.masonlab.net/).
Here’s the recent Metasub paper in case you haven’t seen it and would like to review it later: https://milrd.org/wp-content/uploads/2022/09/Cell_A-global-metagenomic-map-of-urban-microbiomesand-antimicrobial-resistance.pdf
(To be frank, this article is a bit challenging to read, so we suggest you review it later on if you’re inclined, after you’ve done a bit of the project.)
Some additional information in case you’re interested:
New York Times article about the Metasub Project: https://www.nytimes.com/2021/05/26/science/microbes-subway-metasub-mason.html?smid=url-share
Metasub Project website: http://metasub.org
Metasub was borne out of a project called PathoMap (also from the Mason lab), which began in summer 2013 to profile the New York City metagenome in, around, and below NYC on mass-transit areas of the built environment, focusing on the subway.
Here’s the Pathomap paper in case you would like to review it later: https://milrd.org/wp-content/uploads/2022/09/Geospatial-Resolution-of-Human-and-Bacterial-Diversity-with-City-Scale-Metagenomics.pdf
Pathomap sought to establish baseline profiles across the subway system, identify potential bio-threats, and provide an additional level of data that can be used by the city to create a “smart city;” i.e., one that uses high- dimensional data to improve city planning, management, and human health.”
Metasub extended the Pathomap project based on the recognition that NYC is not the only city in the world that could benefit from a systematic, longitudinal metagenomic profile of its subway system.
Although NYC subway has the most stations, it ranks 7th in the world in term of the number of riders per year. A wide variety of population density, length, and climate types define the busiest subways of the world, ranging from cold (Moscow) to temperate (New York City, Paris), to subtropical (Mexico City) and tropical (São Paulo).
To address this gap in our knowledge of the built environment, the Mason lab created Metasub: an international consortium of laboratories to establish a world-wide “DNA map” of microbiomes in mass transit systems.
Take a look at Figure 1, which provides an overview of the Pathomap project’s design and execution:
As you can see, the researchers collected samples from
New York City’s five boroughs
Collected samples from the 466 subway stations of NYC across the 24 subway lines
extracted, sequenced, QC’d and analyzed DNA
Mapped the distribution of taxa identified from the entire pooled dataset, and
presented geospatial analysis of a highly prominent genus, Pseudomonas
Notably, as seen in (D), nearly half of the DNA sequenced (48%) did not match any known organism, underscoring the vast wealth of likely unknown organisms that surround passengers every day.
Think, Room (4-5 ppl), Share
:
1-minute: Why do you think so much of the sequenced DNA did not match any known organism?
3-minutes: divide into breakout rooms and discuss with your group
2-minutes: re-join the main meeting room and present 1-2 examples from your breakout room to the other participants.
Now, let’s focus on Fig 1C, as samples from the Metasub project were collected, sequenced, and analyzed in a similar manner to the Pathomap project. Here’s a simplified version of what the Mason lab did in Fig 1C:
This guide is intended to teach you how to teach you one component of metagenomic analysis: how to plot abundances at the “phylum” level for each metagenomics sample.
Throughout the VTP, each participant characterizes, quantifies and visualize microbial metagenomics data from sequenced swabs of public urban environments on their own AWS High Performance Compute instance. In the Linux terminal, they perform genomic data quality control, genome alignment, taxonomic characterization & abundance quantification, and in R, they viaualize results, conduct a principal component analysis. To conclude, they investigate their most abundant species and use the Patric database to consider how they would determine the strains of these species.
Think, Room (4-5 ppl), Share
:
1-minute: Note that we’re using two programming languages (Linux/Bash and R). Why do you think it’s necessary to use two programming languages, and not just one?
3-minutes: divide into breakout rooms and discuss with your group
2-minutes: re-join the main meeting room and present 1-2 examples from your breakout room to the other participants.
All bioinformatics tasks will be performed in “the cloud” on an Amazon Web Services (AWS) hosted high performance compute instance.
What is cloud computing:
Think, Room (4-5 ppl), Share
:
1-minute: Why do we (as well as professional researchers, data scientists, bioinformaticians) often need to perform analyses on the cloud?
3-minutes: divide into breakout rooms and discuss with your group
2-minutes: re-join the main meeting room and present 1-2 examples from your breakout room to the other participants.
What is R and RStusio
RStudio is an integrated development environment (IDE) for the open-source R programming language, which basically means it brings the core components of R (Scripting Pane, Console, Environment Pane, File Manager/Plots/Help Pane) into a quadrant-based user interface for efficient use.
Here is what the R dashboard looks like:
In R, code is always executed via the Console, but you have the
choice whether to execute that code in a Script (opened in the Scripting
Pane) or directly in the Console. Unless you need to quicly execute a
one-liner (e.g. setting a working directory using the setwd
command), you’ll want to be writing your code in a script, highlighting
it, and clicking Run
to execute it in the console. This is
because you can easily edit code in a script and re-run it. Once code is
run in the Console it is not editable.
You are provided an instance of the R editor RStudio on AWS already waiting for you to use. Login to your AWS-hosted RStudio instance using the URL, username, and password assigned to you in the Google Sheet.
Please make sure the RStudio user interface dashboard looks as follows: Console Pane (Lower Left Quadrant), Scripting Pane (Upper Left Quadrant), File Manager/Plots Display/Help-Tab Pane (Lower Right Quadrant), Environment/History-Tab Pane (Upper Right Quadrant).
In this section, you will learn how to use R to generate two plots that help visualize the similarities and differences between a subset of the Metasub samples and compare it to metagenomics samples from the Human Microbiome project.
We have provided a subset of of metagnomics data
(taxa_table.csv
) and one with, for your convenience. This
file contains taxonomically characterized and quantified metagenomics
data from nine microbiome samples: three from the human microbiome
project, three from the Metasub project, and three from a mystery
source.
First we will plot our samples as a stacked-barplot at the phylum level. A stacked-barplot shows a set of numbers as a series of columns one on top of each other colored by a label. In our case, a taxonomic profile is a set of numerical abundances labeled by the microbial species it belongs to.
Here’s the template code to make this plot in R:
library(ggplot2)
taxa_yourSample = read.csv('yourSample.csv', header=TRUE, sep=',')
phyla_yourSample = taxa_yourSample[taxa_yourSample$rank == 'phylum',]
phyla_yourSample = phyla_yourSample[phyla_yourSample$percent_abundance >= 2,]
ggplot(phyla_yourSample, aes(x=sample, y=percent_abundance, fill=taxon)) +
geom_bar(stat="identity") +
xlab('Sample') +
ylab('Abundance') +
labs(fill='Phylum') +
theme(axis.text.x = element_text(angle = 90))
ggplot2
library into our
environment. The library()
function is used to load
additional libraries that contain functions to be utilized by the script
that follows.read.csv()
function.ggplot()
object.ggplot()
how we want our data to be
displayedggplot()
what our axis labels should
beSave space in your document using buttons or tabs for sub chapters. Add this code at the end of your title:
mini_SL342389
This code generates a phylum-level barplot by modifying
taxa_yourSample
, mini_yourSample.csv
, and
phyla_yourSample
per Example sample.
library(ggplot2)
= read.csv('mini_SL342389_taxa.csv', header=TRUE, sep=',')
taxa_mini_SL342389
= taxa_mini_SL342389[taxa_mini_SL342389$rank == 'phylum',]
phyla_mini_SL342389
= phyla_mini_SL342389[phyla_mini_SL342389$percent_abundance >= 2,]
phyla_mini_SL342389
ggplot(phyla_mini_SL342389 , aes(x=sample, y=percent_abundance, fill=taxon)) +
geom_bar(stat="identity") +
xlab('Sample') +
ylab('Abundance') +
labs(fill='Phylum') +
theme(axis.text.x = element_text(angle = 90))
yourSample
Generate a phylum-level barplot by modifying
taxa_yourSample
, mini_yourSample.csv
, and
phyla_yourSample
per your assigned sample.
library(ggplot2)
= read.csv('yourSample_taxa.csv', header=TRUE, sep=',')
taxa_yourSample
= taxa_yourSample[taxa_yourSample$rank == 'phylum',]
phyla_yourSample
= phyla_yourSample[phyla_yourSample$percent_abundance >= 2,]
phyla_yourSample
ggplot(phyla_yourSample, aes(x=sample, y=percent_abundance, fill=taxon)) +
geom_bar(stat="identity") +
xlab('Sample') +
ylab('Abundance') +
labs(fill='Phylum') +
theme(axis.text.x = element_text(angle = 90))
yourSample
Clear your Console, Environment Tab, and Plots tab using the 🧹 button and re-run the script chunk-by-chunk (noting what each chunk appears to be doing):
library(ggplot2)
+
= read.csv('yourSample_taxa.csv', header=TRUE, sep=',') taxa_yourSample
+
= taxa_yourSample[taxa_yourSample$rank == 'phylum',] phyla_yourSample
+
= phyla_yourSample[phyla_yourSample$percent_abundance >= 2,] phyla_yourSample
+
ggplot(taxa, aes(x=sample, y=percent_abundance, fill=taxon)) +
geom_bar(stat="identity") +
xlab('Sample') +
ylab('Abundance') +
labs(fill='Phylum') +
theme(axis.text.x = element_text(angle = 90))
yourSample
Modify code: edit your script to generate a barplot at the “family” level, by modifying this line of code:
= taxa_yourSample[taxa_yourSample$rank == 'phylum',] phyla_yourSample
Checkpoint (CP) 1
Please upload the following to the Google Sheet:
Barplot at the phylum level. (To download this plot as a file, click the (+) Zoom button, right click on the plot and select “Save Image As”.)
Upload barplot at the family level. (To download this plot as a file, click the (+) Zoom button, right click on the plot and select “Save Image As”.)
Answer to these questions:
taxa_table.csv
file into the taxa
object (copy paste the exact line of
code)?$
operator doing in this line of code:
taxa = taxa[taxa$rank == 'phylum',]
?Access your Linux terminal by logging into RStudio via the web browser (can be found in the the Google Sheet.
Setup to your Linux environment:
It should look like this once you’re finished setting up your Linux environment:
Checkpoint (CP) 2
Please take a screenshot of the last 15 lines of your
history
output and upload it to the Google Sheet.
To make sure you undertstand the workflow, we’d like to first have
you complete the analysis with a small dataset. We’ve taken 50,000 reads
from the read1 and read2 files of each assigned sample. They are labeled
with the prefix mini_
and located in the reads
directory (files without the prefix mini
are the original,
full-size files, which each contain millions of reads.)
Data from each Metasub sample is contained in two files—read1
(i.e. R1
) and read2 (i.e.R2
). This is because
the researchers paired-end sequenced each sample. When samples
are sequenced on an Illumina genomic sequencer researchers get to
decide: (1) the number of reads to generate for each sample library; (2)
the read length (within a range of ~50 - ~300 nucleotides); and (3)
whether to generate a single read or a pair of reads from each sequenced
DNA library fragment.
Here is an diagram that summarizes paired-end versus single-end sequencing:
A FASTQ record has the following format:
Here’s an example of a FASTQ file with two records:
@071112_SLXA-EAS1_s_7:5:1:817:345
GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9IC
@071112_SLXA-EAS1_s_7:5:1:801:338
GTTCAGGGATACGACGTTTGTATTTTAAGAATCTGA
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII6IBI
Navigate to the reads
directory (which contains the
“mini” fastq data):
$ cd ~/reads/
PLEASE NOTE: make sure to complete all steps in this section from the
reads
directory.
Take a look at the first 10 lines of your assigned fastq files:
$ zcat mini_my_reads.R1.fastq.gz | head
$ zcat mini_my_reads.R2.fastq.gz | head
(Please note: mini_my_reads
is a placeholder for your
assigned miniature reads dataset.)
Save space in your document using buttons or tabs for sub chapters. Add this code at the end of your title:
mini_SL342389
Take a look at the first 10 lines of your assigned fastq files:
$ zcat mini_SL342389.R1.fastq.gz | head
$ zcat mini_SL342389.R2.fastq.gz | head
yourSample
Take a look at the first 10 lines of your assigned fastq files:
$ zcat mini_my_reads.R1.fastq.gz | head
$ zcat mini_my_reads.R2.fastq.gz | head
(Please note: mini_my_reads
is a placeholder for your
assigned miniature reads dataset.)
Checkpoint (CP) 3
In the Google Sheet, please:
Upload a screenshot of your zcat results.
Answer these questions:
Check AdapterRemoval
is working by opening your terminal
and typing:
$ AdapterRemoval -h
You should see a long list of all the arguments that can be given to this tool.
Run AdapterRemoval on your mini sample (executable version):
$ AdapterRemoval --file1 mini_my_reads.R1.fastq.gz --file2 mini_my_reads.R2.fastq.gz --trimns --trimqualities --minquality 40 --threads 2 --gzip --output1 clean.mini_my_reads.R1.fastq.gz --output2 clean.mini_my_reads.R2.fastq.gz
Please note: mini_my_reads
is a placeholder for your
assigned sample ID. The file extension .fq
is a widely used
abbreviation for .fastq
.
Run AdapterRemoval on your sample (explanatory version):
$ AdapterRemoval
--file1 mini_my_reads.R1.fastq.gz --file2 mini_my_reads.R2.fastq.gz
--trimns
--trimqualities --minquality 40
--threads 2
--gzip
--output1 clean.mini_my_reads.R1.fastq.gz --output2 clean.mini_my_reads.R2.fastq.gz
Save space in your document using buttons or tabs for sub chapters. Add this code at the end of your title:
mini_SL342389
Run AdapterRemoval on your mini sample (executable version):
$ AdapterRemoval --file1 mini_SL342389.R1.fastq.gz --file2 mini_SL342389.R2.fastq.gz --trimns --trimqualities --minquality 40 --threads 2 --gzip --output1 clean.mini_SL342389.R1.fastq.gz --output2 clean.mini_SL342389.R2.fastq.gz
yourSample
Run AdapterRemoval on your mini sample:
$ AdapterRemoval --file1 mini_my_reads.R1.fastq.gz --file2 mini_my_reads.R2.fastq.gz --trimns --trimqualities --minquality 40 --threads 2 --gzip --output1 clean.mini_my_reads.R1.fastq.gz --output2 clean.mini_my_reads.R2.fastq.gz
Save space in your document using buttons or tabs for sub chapters. Add this code at the end of your title:
mini_SL342389
Look at your clean
… results
$ zcat clean.mini_SL342389.R1.fastq.gz | head
$ zcat clean.mini_SL342389.R2.fastq.gz | head
For comparison, look again at the first 10 lines of your raw reads:
$ zcat mini_SL342389.R1.fastq.gz | head
$ zcat mini_SL342389.R2.fastq.gz | head
Notice any differences between the Clean and Raw reads? If so, write them down.
yourSample
Look at your clean
… results
$ zcat clean.mini_my_reads.R1.fastq.gz | head
$ zcat clean.mini_my_reads.R2.fastq.gz | head
For comparison, look again at the first 10 lines of your raw reads:
$ zcat mini_my_reads.R1.fastq.gz | head
$ zcat mini_my_reads.R2.fastq.gz | head
Notice any differences between the Clean and Raw reads? If so, write them down.
Save space in your document using buttons or tabs for sub chapters. Add this code at the end of your title:
mini_SL342389
Count the number of reads in each of your cleaned fastq files by running:
$ zcat clean.mini_SL342389.R1.fastq.gz | wc -l
and
manually dividing by four.
$ zcat clean.mini_SL342389.R2.fastq.gz | wc -l
and
manually dividing by four.
Count the number of reads in each of your raw (i.e. initial) fastq files by running:
$ zcat mini_SL342389.R1.fastq.gz | wc -l
and manually
dividing by four.
$ zcat mini_SL342389.R2.fastq.gz | wc -l
and manually
dividing by four.
yourSample
Count the number of reads in each of your cleaned fastq files by running:
$ zcat clean.mini_reads.R1.fastq.gz | wc -l
and manually
dividing by four.
$ zcat clean.mini_reads.R2.fastq.gz | wc -l
and manually
dividing by four.
Count the number of reads in each of your raw (i.e. initial) fastq files by running:
$ zcat mini_reads.R1.fastq.gz | wc -l
and manually
dividing by four.
$ zcat mini_reads.R2.fastq.gz | wc -l
and manually
dividing by four.
Record your Raw and Clean read counts to report them in CP4.
Checkpoint (CP) 4
In the Google Sheet, please: 1. Upload a screenshot of your zcat results. 2. Answer these questions:
Researchers often decide at this point to remove DNA from unwanted species, such as human. DNA that we don’t want is called “Contaminating DNA”. We are not going to perform this step due to time constraints.
Launch Kraken (executable version):
(base) user#@ip-#:~/reads $
$ conda install --channel bioconda --yes kraken
conda
is a package manager
install
is a subcommand ofconda
--channel bioconda
--yes
gives conda permission to install software
kraken
is the program we are installing
You should now be able to test Kraken by running:
(base) user#@ip-#:~/reads $
kraken --help
--help
is an option that displays the options for the
tool
If a list of kraken
options and explanations is
displayed, it’s confirmation the tool is running. Provided this happnes,
we can now perform taxonomic classification on our data using this
command:
(base) user#@ip-#:~/reads $
kraken --gzip-compressed --fastq-input --threads 2 --paired --preload --db ~/databases/minikraken_20171101_8GB_dustmasked clean.mini_my_reads.R1.fastq.gz clean.mini_my_reads.R2.fastq.gz > mini_my_reads_taxonomic_report.csv
kraken
command invocation --gzip-compressed
indicates our reads are gzip compressed --fastq-input
indicates our reads are formatted as fastq files --threads
tells the compute instance how many threads to use --paired
indicates we’re using paired end data --preload
specifies
to load the database into RAM before running --db
specifies
the path to the database clean.mini_my_reads.R1.fastq.gz
filepath to Read1 file clean.mini_my_reads.R2.fastq.gz
filepath to Read2 file mini_my_reads_taxonomic_report.csv
filepath to file where kraken
will place results
mini_SL342389
(base) user#@ip-#:~/reads $
kraken --gzip-compressed --fastq-input --threads 2 --paired --preload --db ~/databases/minikraken_20171101_8GB_dustmasked clean.mini_SL342389.R1.fastq.gz clean.mini_SL342389.R2.fastq.gz > mini_SL342389_taxonomic_report.csv
yourSample
(base) user#@ip-#:~/reads $
kraken --gzip-compressed --fastq-input --threads 2 --paired --preload --db ~/databases/minikraken_20171101_8GB_dustmasked clean.mini_my_reads.R1.fastq.gz clean.mini_my_reads.R2.fastq.gz > mini_my_reads_taxonomic_report.csv
BE SURE to replace mysampleID
with your assigned sample
ID.
Once this command runs, take a look at the output by running:
$ head mini_my_reads_taxonomic_report.csv
(the
head
command prints the first 10 lines of any file to the
terminal)
Note Column 1 indicates whether it was classified by Kraken or not. Column 2 denotes the Read ID (line 1 of the fastq read record). Subsequent columns indicated taxonomic mappings, if any.
The mini_my_reads_taxonomic_report.csv
is formatted for
storage efficiency and is not very useful for biological interpretation.
Convert this file to an .mpa
format so that it can be
interpreted more easily:
$ kraken-mpa-report --db ~/databases/minikraken_20171101_8GB_dustmasked mini_my_reads_taxonomic_report.csv > mini_my_reads_final_taxonomic_results.mpa
Look at the first 20 lines by executing:
$ head -20 mini_my_reads_final_taxonomic_results.mpa
Look at the last 20 lines by executing:
$ tail -20 mini_my_reads_final_taxonomic_results.mpa
Pull out the species level assignments in your .mpa
file
and store them in a .tsv
file:
$ grep 's__' mini_my_reads_final_taxonomic_results.mpa > mini_my_reads_species_only.tsv
Look at the first 10 lines:
$ head mini_my_reads_species_only.tsv
See how many species were identified:
$ wc -l mini_my_reads_species_only.tsv
Checkpoint (CP) 5
In the Google Sheet, please:
Upload a screenshot of your kraken
command output.
(i.e. the one that states the % sequences classified and
unclassified)
Upload a screenshot of your
head -20 mini_my_reads_final_taxonomic_results.mpa
command.
Upload a screenshot of your
tail -20 mini_my_reads_final_taxonomic_results.mpa
command.
Answer these questions:
Now create a barplot with all of the metasub samples:
library(ggplot2)
= read.csv('kraken_all_metasub.csv', header=TRUE, sep=',')
taxa_all_barplot
= taxa_all_barplot[taxa_all_barplot$rank == 'phylum',]
taxa_all_barplot
= taxa_all_barplot[taxa_all_barplot$percent_abundance >= 2,]
taxa_all_barplot
ggplot(taxa_all_barplot, aes(x=sample, y=percent_abundance, fill=taxon)) +
geom_bar(stat="identity") +
xlab('Sample') +
ylab('Abundance') +
labs(fill='Phylum') +
theme(axis.text.x = element_text(angle = 90))
Checkpoint (CP) 6
Please upload the following to the Google Sheet:
Read-in all of the Kraken data from the samples you and the other participants analyzed:
= read.csv('kraken_all_metasub.csv', header=TRUE, sep=',')
taxa_all
= taxa_all[taxa_all$rank == 'species',]
taxa_all_spp
= taxa_all_spp[taxa_all_spp$sample == 'SampleID',]
taxa_all_spp_mySampleID
<- taxa_all_spp_mySampleID[order(taxa_all_spp_mySampleID$percent_abundance, decreasing = TRUE), ]
taxa_all_spp_mySampleID_ordered
head(taxa_all_spp_mySampleID_ordered, 5)
For your information, you can open
taxa_all_spp_mySampleID
as a table in the Scripting Pane by
clicking on the name of the object in the Environment Pane. You can
order rows based on the incresing and decreasing values of a specific
column by clicking the ▲ and ▼ arrows of that column.
Checkpoint (CP) 7
In the Google Sheet:
Navigate to the Bacterial and Viral Bioinformatics Resource Center (BV-BRC): https://www.bv-brc.org/
Use the tools in BV-BRC to ID at least one AMR locus/gene for the top 5 most abundant species in your sample.
TAXON OVERVIEW
from the green columnSpecialty Genes
tabFilter
buttonAntibiotic Resitance
efflux pump conferring antibiotic resistance
using the
magnifying glass featureFASTA
option in the green column and select
View FASTA DNA
This will show you the nucleotide sequences
of the selected resistance loci.Here’s a screencast using the species Staphylococcus aureus (Methicillin-resistant Staphylococcus aureus (MRSA) is a widely known antibiotic resistant hospital acquired infection):
Checkpoint (CP) 8
In the Google Sheet:
efflux pump conferring antibiotic resistance
locus IDs for the species you queried using the BV-BRC.While the linux steps can be challenging to perform on a local computuer, students should be able to perform all R/RStudio related steps.
R is free and open source. The Desktop version of RStudio is free.
To use RStudio, you must:
Please feel free to Download the taxa_table.csv
and
kraken_all_metasub.csv
for your own use.
head
, tail
) to
understand the structure/format of the data.$
or @
) to filter or
sort data by specific variables (i.e. columns)summary()
, density()
and plot
to understand the descriptive statistics and
general distribution of a dataset.We would greatly appreciate it if you could complete the POST-VTP Survey: https://forms.gle/ogTzjPW61S4WfVou6